![]() For genetic case-control association analysis, 506 previously genotyped (98 females) participants free of mood, anxiety and substance use disorders according to DSM-IV were used as controls. In addition, 6% of the samples were re-sequenced with the second set of primers to confirm that sequencing had no error. In total, 97% of the samples were successfully sequenced for A118G polymorphism. Ten samples failed sequencing with the first primer set (forward primer: CAGCCAGGACTGGTTTCTGT and reverse primer: TGACCAGGAAGTTTCCGAAG) and were re-sequenced with a second set (forward primer: TACTCCTTGGATCGCTTTGC and reverse primer: GATGGAGTAGAGGGCCATGA). The genotypes were analysed on Applied Bio-systems Variant Reporter software (version 1.0). Standard methods were used to extract DNA from the samples and sequence the OPRM1 A118G polymorphism at the Institute for Molecular Medicine Finland (FIMM), Technology Centre and University of Helsinki. Saliva samples were collected using Oragene DNA Self-Collection Kit OG-500 (DNAgenotek) according to the manufacturer's instructions. Excluded individuals were directed to online self-help websites. acute hepatitis, severe liver or kidney dysfunction, substance abuse or pregnancy), simultaneous participation in other PG-related trials, lack of reliable contact information, being a prisoner, mental retardation or use of opioid antagonists or agonists. Exclusion criteria were severe depression (Finnish Depression Scale (DEPS) score ≥25), bipolar disorder (indication of mania/hypomania with Mood Disorder Questionnaire (MDQ) ), suicide risk (assessed by a medical doctor), self-reported medical conditions (e.g. The inclusion criteria were age 18 or over, ability to speak Finnish, meeting the criteria for PG by Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) and a score of five or over in SOGS-R. material, see The main inclusion criterion at prescreening over telephone was a score of 5 or over in the South Oaks Gambling Screen-Revised (SOGS-R). Screening 236 persons recruited through advertisements in widely distributed free newspapers and announcements in gambling-related websites yielded 101 eligible participants (online suppl. Replication by larger scale studies is warranted to further evaluate naltrexone administration schedules for the treatment of PG and the role of OPRM1. ![]() Conclusion: Overall, the as-needed naltrexone may not provide substantial additional benefit for PG patients receiving psychosocial support. In an exploratory analysis, emotional well-being increased in a subgroup of participants with AA genotype of opioid receptor, mu 1 (OPRM1) A118G polymorphism (p = 0.02). Results: No significant treatment group differences were found. The results were analysed using the intention-to-treat principle and linear random effects modelling. In addition, RAND-36 scales of emotional well-being and social functioning were used as outcomes. Secondary gambling-related outcome measures included thoughts/urges and behaviour subscales of PG-YBOCS as well as the highest daily expenditure and gambling frequency. The primary outcome measure was the severity of PG assessed by the Yale-Brown Obsessive Compulsive Scale adapted for PG (PG-YBOCS). ![]() Methods: The participants (n = 101) received either as-needed placebo or naltrexone (50 mg) and psychosocial support for 20 weeks. The efficacy of as-needed naltrexone was assessed in a single-centre, randomised, double-blind, placebo-controlled trial. Background/Aims: Effective treatment strategies are needed for the treatment of pathological gambling (PG).
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |